circad | circRNAs associated with diseases

circHIAT1
Gene	HIAT1	Organism	Human
Genome Locus		Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink		PMID	31108351
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Samples of the HCC tissues and paired adjacent non-tumor tissues (n"�="�80)
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CGGCCAAGATTCCATAGTGCT Reverse TGCTGTCAATAGTCCCCAAGC	Statistics	Fold Change : Downregulated pvalue : <0.05
Citation
Wang, Z, Zhao, Y, Wang, Y, Jin, C (2019). Circular RNA circHIAT1 inhibits cell growth in hepatocellular carcinoma by regulating miR-3171/PTEN axis. Biomed. Pharmacother., 116:108932.